Previously described [42]. Briefly, lumbar spinal cords were sectioned in a cryostat

Previously described [42]. Briefly, lumbar spinal cords were sectioned in a cryostat, stained with cresyl violet, and their motor neurons harvested using the PixCell 2 LCM System and CapSure HS LCM Caps (Arcturus Engineering). Typically, 4?00 motor neurons were collected from each mouse. Purity of the mRNA was confirmed by measuring the abundance of a glial marker, glial fibrillary acidic protein.Is BMP4 a motor neuron survival factor?Classical survival factors for motor neurons are derived from their peripherals. The characteristics of BMP4 fit most criteria for being a physiological survival factor for motor neurons, although our in vitro experiments can only partial SC 66 answer this question (Fig. 6). Motor neurons are particularly vulnerable to glutamateinduced cell death, 23977191 and the inhibition of glutamate release with riluzole can prolong survival of patients with motor neuron diseases [39]. Evidence for excitotoxicity in motor neuron diseasesRNA preparation, cDNA synthesis, and real-time PCRTotal RNA was prepared using the RNeasy Mini Kit (Qiagen). The RNA was treated with DNase and converted to cDNA using oligo-d(T)15 (Invitrogen) and SuperScript III reverse transcriptase (Invitrogen) as described previously [43]. Real-time PCR reactionsBMP4 and Motor Neuronwere performed using a 7300 Real-Time PCR System (Applied Biosystems), SYBR Green Master Mix (Applied Biosystems) and gene-specific primers were CTTCATTGACCTCAACTA and TTCACACCCATCACAAAC for GAPDH; CAGCTGCAAGAGACACCCTTTGTAT and ATGCCTTAGGGATTTTGGAATTCA for BMP2; TCGCCATTCACTATACGTGGACTT and CACAACAGGCCTTAGGGATACTAGA for BMP4; GCCATCTCGGTTCTTTACTTCGAT and GTGGTTTAAGGCAGATGTTGTTGTT for BMP6; AGGATCAGGTGAAAAGATCAAGAGA and GCAAGGTACACAGCAGTGCTAGATT for BMPRII; GTGCTCCTGCTTCGAGTCCTTAA and AACCGCATCACCATTCCTGTACA for GFAP. A two-step PCR reaction was carried out with denaturation at 95uC for 15 seconds, annealing and extension combined at 60uC for one minute in a total of 40 cycles. The mRNA Avasimibe site expression level of each target gene compared to GAPDH was quantified by subtraction: Cttarget ?CtGAPDH = DCt. A difference of one PCR cycle equates to a 2fold change in mRNA expression level. Data were calculated using GAPDH expression level as 100 . The uniqueness of amplicons was analyzed using dissociation curves.lecular Probes). Non-specific binding was controlled for by replacing the primary antibody with non-immune IgG (Sigma). The immunofluorescent intensity and overlapping area was quantified using Image J software.Cell culturesThe embryonic motor neuron cultures were performed as described previously [42]. Recombinant human BMP4 (R D System) was added immediately after seeding. Half the volume of medium was changed after 2 days. Four days after plating, the cultures were stained with antibody to the motor neuron marker, anti-islet-1 (39.4D5, Developmental Studies Hybridoma Bank), and the immunoreactivity was developed as above, by using biotinylated-anti-mouse IgG (Jackson ImmunoResearch). The numbers of surviving motor neurons were determined by counting islet-1 positive neurons under a microscope (106 eyepiece and 206 objective lens). Mouse muscle cells (C2C12) and neuroblastoma 6 glioma hybrid cells (NG108-15) were obtained from Taiwan National Health Research Institute’s Cell Bank. C2C12 cells were grown as myoblasts in medium containing Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 20 fetal bovine serum (FBS), 100 U/ml penicillin G, and 100 mg/ml streptomycin. C2C12 myobla.Previously described [42]. Briefly, lumbar spinal cords were sectioned in a cryostat, stained with cresyl violet, and their motor neurons harvested using the PixCell 2 LCM System and CapSure HS LCM Caps (Arcturus Engineering). Typically, 4?00 motor neurons were collected from each mouse. Purity of the mRNA was confirmed by measuring the abundance of a glial marker, glial fibrillary acidic protein.Is BMP4 a motor neuron survival factor?Classical survival factors for motor neurons are derived from their peripherals. The characteristics of BMP4 fit most criteria for being a physiological survival factor for motor neurons, although our in vitro experiments can only partial answer this question (Fig. 6). Motor neurons are particularly vulnerable to glutamateinduced cell death, 23977191 and the inhibition of glutamate release with riluzole can prolong survival of patients with motor neuron diseases [39]. Evidence for excitotoxicity in motor neuron diseasesRNA preparation, cDNA synthesis, and real-time PCRTotal RNA was prepared using the RNeasy Mini Kit (Qiagen). The RNA was treated with DNase and converted to cDNA using oligo-d(T)15 (Invitrogen) and SuperScript III reverse transcriptase (Invitrogen) as described previously [43]. Real-time PCR reactionsBMP4 and Motor Neuronwere performed using a 7300 Real-Time PCR System (Applied Biosystems), SYBR Green Master Mix (Applied Biosystems) and gene-specific primers were CTTCATTGACCTCAACTA and TTCACACCCATCACAAAC for GAPDH; CAGCTGCAAGAGACACCCTTTGTAT and ATGCCTTAGGGATTTTGGAATTCA for BMP2; TCGCCATTCACTATACGTGGACTT and CACAACAGGCCTTAGGGATACTAGA for BMP4; GCCATCTCGGTTCTTTACTTCGAT and GTGGTTTAAGGCAGATGTTGTTGTT for BMP6; AGGATCAGGTGAAAAGATCAAGAGA and GCAAGGTACACAGCAGTGCTAGATT for BMPRII; GTGCTCCTGCTTCGAGTCCTTAA and AACCGCATCACCATTCCTGTACA for GFAP. A two-step PCR reaction was carried out with denaturation at 95uC for 15 seconds, annealing and extension combined at 60uC for one minute in a total of 40 cycles. The mRNA expression level of each target gene compared to GAPDH was quantified by subtraction: Cttarget ?CtGAPDH = DCt. A difference of one PCR cycle equates to a 2fold change in mRNA expression level. Data were calculated using GAPDH expression level as 100 . The uniqueness of amplicons was analyzed using dissociation curves.lecular Probes). Non-specific binding was controlled for by replacing the primary antibody with non-immune IgG (Sigma). The immunofluorescent intensity and overlapping area was quantified using Image J software.Cell culturesThe embryonic motor neuron cultures were performed as described previously [42]. Recombinant human BMP4 (R D System) was added immediately after seeding. Half the volume of medium was changed after 2 days. Four days after plating, the cultures were stained with antibody to the motor neuron marker, anti-islet-1 (39.4D5, Developmental Studies Hybridoma Bank), and the immunoreactivity was developed as above, by using biotinylated-anti-mouse IgG (Jackson ImmunoResearch). The numbers of surviving motor neurons were determined by counting islet-1 positive neurons under a microscope (106 eyepiece and 206 objective lens). Mouse muscle cells (C2C12) and neuroblastoma 6 glioma hybrid cells (NG108-15) were obtained from Taiwan National Health Research Institute’s Cell Bank. C2C12 cells were grown as myoblasts in medium containing Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 20 fetal bovine serum (FBS), 100 U/ml penicillin G, and 100 mg/ml streptomycin. C2C12 myobla.