Ecting cells with wild type (2365 hP2) or its UKI-1 custom synthesis mutant (2340/2315 hP2) and plasmid overexpressing Sp1, Sp3, USF1 or USF2 were presented as fold change relative to those obtained from those co-transfected with WT with empty vector (pcDNA3) which was arbitrarily set at 1. *p#0.01. doi:10.1371/Lecirelin journal.pone.0055139.gDistal Promoter of the Human Pyruvate CarboxylaseTable 1. Oligonucleotides used for construction of 59trucated hP2 promoter.Table 2. Oligonucleotides used for generation of 25 bp deletion of 2365/2240 hP2, 15 bp deletion of 2114/239 hP2 and 5 bp deletion of 2114/239 hP2 promoter constructs.Primer name 2985 bp hP2-F 2640 bp hP2-F 2365 bp hP2-F 2240 bp hP2-F 2114 bp hP2-F 241 bp hP2-F 239 bp hP2-RSequences (59 to 39) GGTACCTTGTCCTAATCGCCTACTTGC GGTACCTTGCCCAAGGTCACACAGACG GGTACCCAATAACTGCGAGCCACAGC GGTACCGCCTCGCCACTTATCCAGGCG GGTACCGGAGAACACTGCCCAATAACG GGTACCCTGCAGCAAGTTCGGTTGCACG CTCGAGGTCCTCGCCGCCGCCTCTACCLength (bp) 27 27 26 27 27 28 27 2365/2340 hP2-F 2365/2340 hP2-R 2340/2315 hP2-F 2340/2315 hP2-R 2315/2290 hP2-F 2315/2290 hP2-R TCGATTGGTACCCACTTCCGCCTA TAGGCGGAAGTGGGTACCAATCGA CCACAGCCCGGCCTAGGGTCCGGC GCCGGACCCTAGGCCGGGCTGTGG TGCGGGCGTCGGCTCCGGAGACAA TTGTCTCCGGAGCCGACGCCCGCA GCCCACGTGAGGGGTGCGCCAGGG CCCTGGCGCACCCCTCACGTGGGC GGAGTAGGCGGTGCCTCGCCACTT AAGTGGCGAGGCACCGCCTACTCC TCGATAGGTACCATAACGGGAGGG CCCTCCCGTTATGGTACCTATCGA GAACACTGCCCAGGGCTGTCTGGG CCCAGACAGCCCTGGGCAGTGTTC ACGGGAGGGGTTATAGGAAGTCCG CGGACTTCCTATAACCCCTCCCGT CTGTCTGGGCCAGGCGGGGCCGGG CCCGGCCCCGCCTGGCCCAGACAG GGGCTGTCTGGGAGGAAGTCCGTA TACGGACTTCCTCCCAGACAGCCC GGAAGTCCGTAAGCAGCAAGTTCG CGAACTTGCTGCTTACGGACTTCC 254/239 hP2 271/267 hP2 269/254 hP2 284/269 hP2 299/284 hP2 2114/299 hP2 2265/2240 hP2 2290/2265 hP2 2315/2290 hP2 2340/2315 hP2 2365/2340 hP2 Primer name Sequences (59 to 39) Construct name*Restriction enzyme recognition sites are underlined. doi:10.1371/journal.pone.0055139.t2290/2265 hP2-F 2290/2265 hP2-R 2265/2240 hP2-F 2265/2240 hP2-R 2114/299 hP2-F 2114/299 hP2-R 299/284 hP2-F 299/284 hP2-R 284/269 hP2-F 284/269 hP2-R 269/254 hP2-F 269/254 hP2-R 271/267 hP2-F 271/267 hP2-R 254/239 hP2-F 254/239 hP2-RSite-directed MutagenesisSite-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent Technologies) was performed to generate 5, 15 and 25 nucleotide internal deletion mutants of the hP2 promoter constructs. The mutagenesis reaction was carried on in a total volume of a 50 ml-reaction mixture containing 300 ng of DNA template, 125 ng of each mutagenic oligonucleotide primer, 10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris-HCl pH 8.8, 2 mM MgSO4, 0.1 TritonX-100 and 0.1 mg/ml nuclease-free bovine serum albumin (BSA), 200 mM dNTP mix, and 2.5 U of PfuTurbo polymerase (Stratagene-Agilent Technologies). The amplification profile consisted of an initial denaturation at 95uC for 30 sec followed by 20
cycles of denaturation at 95uC for 30 sec, annealing at 55uC for 1 min, and extension at 68uC for 10 min. The primers used for site-directed mutagenesis are shown in Tables 1 and 2. The correct mutant constructs were verified by automated nucleotide sequencing. The corrected clones with 5, 15 or 25 nucleotide deletion were double digested with KpnI and XhoI and re-ligated into the pGL3 basic vector digested with the same enzymes.doi:10.1371/journal.pone.0055139.t(Promega), while the b-galactosidase assay was performed using ONPG as substrate.Cell Culture and TransfectionINS-1 832/13 cells [35] were maintained in RPMI 1640 supplemented with 28 mmol/l NaHCO.Ecting cells with wild type (2365 hP2) or its mutant (2340/2315 hP2) and plasmid overexpressing Sp1, Sp3, USF1 or USF2 were presented as fold change relative to those obtained from those co-transfected with WT with empty vector (pcDNA3) which was arbitrarily set at 1. *p#0.01. doi:10.1371/journal.pone.0055139.gDistal Promoter of the Human Pyruvate CarboxylaseTable 1. Oligonucleotides used for construction of 59trucated hP2 promoter.Table 2. Oligonucleotides used for generation of 25 bp deletion of 2365/2240 hP2, 15 bp deletion of 2114/239 hP2 and 5 bp deletion of 2114/239 hP2 promoter constructs.Primer name 2985 bp hP2-F 2640 bp hP2-F 2365 bp hP2-F 2240 bp hP2-F 2114 bp hP2-F 241 bp hP2-F 239 bp hP2-RSequences (59 to 39) GGTACCTTGTCCTAATCGCCTACTTGC GGTACCTTGCCCAAGGTCACACAGACG GGTACCCAATAACTGCGAGCCACAGC GGTACCGCCTCGCCACTTATCCAGGCG GGTACCGGAGAACACTGCCCAATAACG GGTACCCTGCAGCAAGTTCGGTTGCACG CTCGAGGTCCTCGCCGCCGCCTCTACCLength (bp) 27 27 26 27 27 28 27 2365/2340 hP2-F 2365/2340 hP2-R 2340/2315 hP2-F 2340/2315 hP2-R 2315/2290 hP2-F 2315/2290 hP2-R TCGATTGGTACCCACTTCCGCCTA TAGGCGGAAGTGGGTACCAATCGA CCACAGCCCGGCCTAGGGTCCGGC GCCGGACCCTAGGCCGGGCTGTGG TGCGGGCGTCGGCTCCGGAGACAA TTGTCTCCGGAGCCGACGCCCGCA GCCCACGTGAGGGGTGCGCCAGGG CCCTGGCGCACCCCTCACGTGGGC GGAGTAGGCGGTGCCTCGCCACTT AAGTGGCGAGGCACCGCCTACTCC TCGATAGGTACCATAACGGGAGGG CCCTCCCGTTATGGTACCTATCGA GAACACTGCCCAGGGCTGTCTGGG CCCAGACAGCCCTGGGCAGTGTTC ACGGGAGGGGTTATAGGAAGTCCG CGGACTTCCTATAACCCCTCCCGT CTGTCTGGGCCAGGCGGGGCCGGG CCCGGCCCCGCCTGGCCCAGACAG GGGCTGTCTGGGAGGAAGTCCGTA TACGGACTTCCTCCCAGACAGCCC GGAAGTCCGTAAGCAGCAAGTTCG CGAACTTGCTGCTTACGGACTTCC 254/239 hP2 271/267 hP2 269/254 hP2 284/269 hP2 299/284 hP2 2114/299 hP2 2265/2240 hP2 2290/2265 hP2 2315/2290 hP2 2340/2315 hP2 2365/2340 hP2 Primer name Sequences (59 to 39) Construct name*Restriction enzyme recognition sites are underlined. doi:10.1371/journal.pone.0055139.t2290/2265 hP2-F 2290/2265 hP2-R 2265/2240 hP2-F 2265/2240 hP2-R 2114/299 hP2-F 2114/299 hP2-R 299/284 hP2-F 299/284 hP2-R 284/269 hP2-F 284/269 hP2-R 269/254 hP2-F 269/254 hP2-R 271/267 hP2-F 271/267 hP2-R 254/239 hP2-F 254/239 hP2-RSite-directed MutagenesisSite-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent Technologies) was performed to generate 5, 15 and 25 nucleotide internal deletion mutants of the hP2 promoter constructs. The mutagenesis reaction was carried on in a total volume of a 50 ml-reaction mixture containing 300 ng of DNA
template, 125 ng of each mutagenic oligonucleotide primer, 10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris-HCl pH 8.8, 2 mM MgSO4, 0.1 TritonX-100 and 0.1 mg/ml nuclease-free bovine serum albumin (BSA), 200 mM dNTP mix, and 2.5 U of PfuTurbo polymerase (Stratagene-Agilent Technologies). The amplification profile consisted of an initial denaturation at 95uC for 30 sec followed by 20 cycles of denaturation at 95uC for 30 sec, annealing at 55uC for 1 min, and extension at 68uC for 10 min. The primers used for site-directed mutagenesis are shown in Tables 1 and 2. The correct mutant constructs were verified by automated nucleotide sequencing. The corrected clones with 5, 15 or 25 nucleotide deletion were double digested with KpnI and XhoI and re-ligated into the pGL3 basic vector digested with the same enzymes.doi:10.1371/journal.pone.0055139.t(Promega), while the b-galactosidase assay was performed using ONPG as substrate.Cell Culture and TransfectionINS-1 832/13 cells [35] were maintained in RPMI 1640 supplemented with 28 mmol/l NaHCO.