N) which were washed with binding buffer prior to adding the

N) which were washed with binding buffer prior to adding the reaction. The beads were allowed to bind the nucleoprotein complex for 1 hr then washed with 400 ml of wash buffer (20 mM HEPES pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.2 mM EGTA, 20 glycerol, 0.1 nonidet P40, 0.5 mM DTT, 20 mM imidazole) for 5 min. Following the wash, the bound nucleoprotein complexes were eluted with elution buffer (wash buffer with 250 mM imidazole). 10 ml of the 3PO web purified complex was PCR amplified with primer F and primer R (CAGGTCAGTTCAGCGGATCCTGTCG) for 15 cycles. The amplification product was purified using High Pure PCR Cleanup Micro Kit (Roche) and quantified using Picogreen (Invitrogen). 0.2 ng of the purified oligonucleotide was used in subsequent rounds of site selection. After 4 rounds of selection, the PCR amplified oligonucleotides were ethanol precipitated and cloned into pCRII-TOPO or pCR2.1-TOPO using TOPO-TA cloning (Invitrogen). Each pCRII or pCR2.1 clone was then sequenced using M13-reverse or M13-forward primers respectively. In total, 54 clones generated usable sequences.AcknowledgmentsWe would like to thank Ingrid MacIndoe for providing us with the raw data from her site selection experiments on mouse Tbx20.Author ContributionsConceived and designed the experiments: NN JRR WJB. Performed the experiments: NN. Analyzed the data: NN. Contributed reagents/ materials/analysis tools: NN JRR. Wrote the paper: NN WJB.
Cancer represents one of the greatest health risks worldwide. Consequently, there is a growing need for developing novel therapeutics and new advances in animal tumour modelling. However, despite much progress in this field, the development of clinically relevant animal models that permit rapid and sensitive monitoring of early tumour growth and subsequent metastasis remains an on-going challenge [1]. Many conventional animal tumour models used in the development of anticancer treatments involve injection of human tumour cells into immunocompromised mice [2,3] followed by standard calliper measurements to assess tumour size, usually as an end-point measurement, after the animal has been sacrificed. These models are fairly limited and research has been on-going to develop a genetically marked tumour that would enable non-invasive monitoring of the tumour parameters by in vivo imaging based on light emission from luciferaseexpressing cells or fluorescence from GFP-expressing cells [1]. The use of genetically marked tumour cells in an animal cancer model has a number of advantages. Primarily, it allows one to monitor the efficacy of therapeutic interventions such as drug, gene or cell therapies more easily than with conventional models. It buy POR 8 facilitates tracking of tumour parameters, such as size and development, as well as enables highly sensitive visualisation of early metastasis and the evaluation of minimal residualdisease after therapy [4]. It also permits the use of sequential measurements to follow tumour size during treatment so that longitudinal studies can be performed to analyse the effects of therapies over time giving more reliable information and reducing the number of experimental animals [5]. In past studies, a variety of different methods have been employed to endow tumour cells with detectable markers [1,4,6,7,8,9]. The most effective method for delivering genes to cells is the use of vectors derived from modified viruses [10]. However, despite the advantages of this gene delivery system there are also significant limitatio.N) which were washed with binding buffer prior to adding the reaction. The beads were allowed to bind the nucleoprotein complex for 1 hr then washed with 400 ml of wash buffer (20 mM HEPES pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.2 mM EGTA, 20 glycerol, 0.1 nonidet P40, 0.5 mM DTT, 20 mM imidazole) for 5 min. Following the wash, the bound nucleoprotein complexes were eluted with elution buffer (wash buffer with 250 mM imidazole). 10 ml of the purified complex was PCR amplified with primer F and primer R (CAGGTCAGTTCAGCGGATCCTGTCG) for 15 cycles. The amplification product was purified using High Pure PCR Cleanup Micro Kit (Roche) and quantified using Picogreen (Invitrogen). 0.2 ng of the purified oligonucleotide was used in subsequent rounds of site selection. After 4 rounds of selection, the PCR amplified oligonucleotides were ethanol precipitated and cloned into pCRII-TOPO or pCR2.1-TOPO using TOPO-TA cloning (Invitrogen). Each pCRII or pCR2.1 clone was then sequenced using M13-reverse or M13-forward primers respectively. In total, 54 clones generated usable sequences.AcknowledgmentsWe would like to thank Ingrid MacIndoe for providing us with the raw data from her site selection experiments on mouse Tbx20.Author ContributionsConceived and designed the experiments: NN JRR WJB. Performed the experiments: NN. Analyzed the data: NN. Contributed reagents/ materials/analysis tools: NN JRR. Wrote the paper: NN WJB.
Cancer represents one of the greatest health risks worldwide. Consequently, there is a growing need for developing novel therapeutics and new advances in animal tumour modelling. However, despite much progress in this field, the development of clinically relevant animal models that permit rapid and sensitive monitoring of early tumour growth and subsequent metastasis remains an on-going challenge [1]. Many conventional animal tumour models used in the development of anticancer treatments involve injection of human tumour cells into immunocompromised mice [2,3] followed by standard calliper measurements to assess tumour size, usually as an end-point measurement, after the animal has been sacrificed. These models are fairly limited and research has been on-going to develop a genetically marked tumour that would enable non-invasive monitoring of the tumour parameters by in vivo imaging based on light emission from luciferaseexpressing cells or fluorescence from GFP-expressing cells [1]. The use of genetically marked tumour cells in an animal cancer model has a number of advantages. Primarily, it allows one to monitor the efficacy of therapeutic interventions such as drug, gene or cell therapies more easily than with conventional models. It facilitates tracking of tumour parameters, such as size and development, as well as enables highly sensitive visualisation of early metastasis and the evaluation of minimal residualdisease after therapy [4]. It also permits the use of sequential measurements to follow tumour size during treatment so that longitudinal studies can be performed to analyse the effects of therapies over time giving more reliable information and reducing the number of experimental animals [5]. In past studies, a variety of different methods have been employed to endow tumour cells with detectable markers [1,4,6,7,8,9]. The most effective method for delivering genes to cells is the use of vectors derived from modified viruses [10]. However, despite the advantages of this gene delivery system there are also significant limitatio.