Ent of skin tumors and facilitated chemical-induced skin carcinogenesis. Even in

Ent of skin tumors and facilitated chemical-induced skin carcinogenesis. Even in esophagus studies, contradictory results exist. Lu et al[17] in a study of Notch signaling in a squamous cancer cell line indicates its G1/G0 maintenance, which may suggest its function as stemness maintaining factor. However, other reports indicate its function in esophageal epithelial cell differentiation [22,34]. Therefore, Notch1 expression in tumors may function as a double-edged sword[47], most probably depending on the whole complex a given tumor faces. We speculate the following possibility for Notch1 expression in these tumors: Notch1 may play an important role in carcinogenic process as indicated in different studies [5,48]. However, double edge function of Notch1 do exist, not only because there are strong lines of evidence as suppressor[47,49], but also because about one fourth of the tumors in our study were negative for Notch1 expression; Functional mutation of Notch1 may trigger Notch1 overexpression in the rest cells of tumor by a till now unexplored mechanism, so that both functional mutation and overexpression of Notch1 may exist in the same tumors in different phases of tumor development. The overexpression of Notch1 may endorse the tumor cells with higher stemness, more therapy-resistance and strong potential in invasion and metastasis as partly indicated in our study and partly in literature, while functional mutation of Notch1 may play an important role in tumor initiation. However, the Notch1 negative tumors may in general be less aggressive as verified in our current study, most probably due to lack of Notch1 function. That the Hes-1 expression in these tumors was not associated with poor survival as Notch1 did may indicate aberrant Notch1 signaling which merits further studies. In summary, the aggressive KYSE70 human esophageal squamous cell carcinoma cell line is positive for Notch1 expression, and such expression is hypoxia-inducible; the less aggressive KYSE450 human squamous 22948146 cell carcinoma cell line is negative for Notch1 and the Notch1 expression in this cell line is not inducible; the KYSE70 cell line is more 5-FU resistant than the KYSE450 cell line, and such 5-FU resistance is correlated to Notch1 expression verified by Notch1 siRNA experiment; Notchexpression is positive in the basal layer of human esophagus AZP-531 chemical information epithelia, and its expression in squamous cell carcinomas is significantly correlated to higher pathological grade and shorter survival. The molecular mechanism behind these findings warrants additional studies.Supporting InformationFigure S1 Forward primer sequencing result of Notch1 in KYSE 70 human esophageal squamous cell carcinoma cells (from 5’to 3′):GGCATGGTGCCGAACCAATACAACCCTCTGCGGGGGAGTGTGGCACCAGGCCCCCTGAGCACACAGGCCCCCTCCCTGCAGCATGGCATGGTAGGCCCGCTGCACAGTAGCCTTGCTGCCAGCGCCCTGTCCCAGATGATGAGCTACCAGGGCCTGCCCAGCACCCGGCTGGCCACCCAGCCTCACCTGGTGCAGACCCAGCAGGTGCAGCCACAAAACTTACAGATGCAGCAGCAGAACCTGCAGCCAGCAAACA. (TIF) Figure S2 Reward primer sequencing result of Notch1 in KYSE 70 human esophageal squamous cell carcinoma cells (from 5’to 3′):GGTCCACCAGTTTGAATGGTCAATGCGAGTGGCTGTCCCGGCTGCAGAGCGGCATGGTGCCGAACCAATACAACCCTCTGCGGGGGAGTGTGGCACCAGGCCCCCTGAGCACACAGGCCCCCTCCCTGCAGCATGGCATGGTAGGCCCGCTGCACAGTAGCCTTGCTGCCAGCGCCCTGTCCCAGATGATGAGCTACCAGGGCCTGCCCAGCACCCGGCTGGCCACCCAGCCTCACCTGGTGCAGACCCAGCAGGTGCAGCCACAAAAA. (TIF)AcknowledgmentsWe are grateful to Ellen Hellesylt, Mette Synn e F sund, Mai AZP-531 web Nguyen, Trinh Don and Leni T devold M.Ent of skin tumors and facilitated chemical-induced skin carcinogenesis. Even in esophagus studies, contradictory results exist. Lu et al[17] in a study of Notch signaling in a squamous cancer cell line indicates its G1/G0 maintenance, which may suggest its function as stemness maintaining factor. However, other reports indicate its function in esophageal epithelial cell differentiation [22,34]. Therefore, Notch1 expression in tumors may function as a double-edged sword[47], most probably depending on the whole complex a given tumor faces. We speculate the following possibility for Notch1 expression in these tumors: Notch1 may play an important role in carcinogenic process as indicated in different studies [5,48]. However, double edge function of Notch1 do exist, not only because there are strong lines of evidence as suppressor[47,49], but also because about one fourth of the tumors in our study were negative for Notch1 expression; Functional mutation of Notch1 may trigger Notch1 overexpression in the rest cells of tumor by a till now unexplored mechanism, so that both functional mutation and overexpression of Notch1 may exist in the same tumors in different phases of tumor development. The overexpression of Notch1 may endorse the tumor cells with higher stemness, more therapy-resistance and strong potential in invasion and metastasis as partly indicated in our study and partly in literature, while functional mutation of Notch1 may play an important role in tumor initiation. However, the Notch1 negative tumors may in general be less aggressive as verified in our current study, most probably due to lack of Notch1 function. That the Hes-1 expression in these tumors was not associated with poor survival as Notch1 did may indicate aberrant Notch1 signaling which merits further studies. In summary, the aggressive KYSE70 human esophageal squamous cell carcinoma cell line is positive for Notch1 expression, and such expression is hypoxia-inducible; the less aggressive KYSE450 human squamous 22948146 cell carcinoma cell line is negative for Notch1 and the Notch1 expression in this cell line is not inducible; the KYSE70 cell line is more 5-FU resistant than the KYSE450 cell line, and such 5-FU resistance is correlated to Notch1 expression verified by Notch1 siRNA experiment; Notchexpression is positive in the basal layer of human esophagus epithelia, and its expression in squamous cell carcinomas is significantly correlated to higher pathological grade and shorter survival. The molecular mechanism behind these findings warrants additional studies.Supporting InformationFigure S1 Forward primer sequencing result of Notch1 in KYSE 70 human esophageal squamous cell carcinoma cells (from 5’to 3′):GGCATGGTGCCGAACCAATACAACCCTCTGCGGGGGAGTGTGGCACCAGGCCCCCTGAGCACACAGGCCCCCTCCCTGCAGCATGGCATGGTAGGCCCGCTGCACAGTAGCCTTGCTGCCAGCGCCCTGTCCCAGATGATGAGCTACCAGGGCCTGCCCAGCACCCGGCTGGCCACCCAGCCTCACCTGGTGCAGACCCAGCAGGTGCAGCCACAAAACTTACAGATGCAGCAGCAGAACCTGCAGCCAGCAAACA. (TIF) Figure S2 Reward primer sequencing result of Notch1 in KYSE 70 human esophageal squamous cell carcinoma cells (from 5’to 3′):GGTCCACCAGTTTGAATGGTCAATGCGAGTGGCTGTCCCGGCTGCAGAGCGGCATGGTGCCGAACCAATACAACCCTCTGCGGGGGAGTGTGGCACCAGGCCCCCTGAGCACACAGGCCCCCTCCCTGCAGCATGGCATGGTAGGCCCGCTGCACAGTAGCCTTGCTGCCAGCGCCCTGTCCCAGATGATGAGCTACCAGGGCCTGCCCAGCACCCGGCTGGCCACCCAGCCTCACCTGGTGCAGACCCAGCAGGTGCAGCCACAAAAA. (TIF)AcknowledgmentsWe are grateful to Ellen Hellesylt, Mette Synn e F sund, Mai Nguyen, Trinh Don and Leni T devold M.